Argyll robertson pupil2/19/2023 ![]() ![]() Therefore, it may be that the lesion for light-near dissociation is located between the pretectal nucleus and the Edinger-Westphal nucleus. Their pathways are different from that of the light reflex until they reach the Edinger-Westphal nucleus. The near reflex consists of both the convergence reflex and the accommodation reflex. The light reflex pathway reaches the Edinger-Westphal nucleus through the pretectal nucleus. Pupillary reactions are divided into light reflexes and near reflexes. A sequencing analysis for patient 1 indicated a CAG repeat number of 60/27 (Dr Igarashi, Niigata University). Patients 1 and 2 showed the CAG repeat expansion in the SCA1 gene. 2 The products of PCR were separated by electrophoresis (2% agarose) with ethidium bromide staining. ![]() To detect CAG expansion in the SCA1 region, we performed a polymerase chain reaction (PCR) with Rep-2 (5′ CAACATGGGCAGTCTGAG 3′) and Rep-1 (5′ AACTGGAAATGTGGGCGTAC 3′) according to Orr et al. Total DNA was extracted by the phenol/chloroform method from peripheral blood leucocytes. Their father showed no abnormalities on neurological examination.īlood was collected for molecular studies with informed consent from both patients and their father. Babinski’s sign was positive in both feet, although there were no signs of spastic or ataxic movement in his limbs and in his gait. The distal portion of the upper limbs was slightly weak and the deep tendon reflexes in the limbs were slightly accentuated. Although the light reflex was absent, the near reflex was normal. On examination, he presented pupillary abnormalities which were similar to those of patient 1 (mydriasis 6.5 mm, light-near dissociation). He received dialysis three times a week because he had renal failure due to pyelonephritis. He consulted our clinic for examination, although he had not experienced any neurological problems. Patient 2 was a 20 year old man, the brother of patient 1. 99mTechnetium-hexamethylpropyleneamine oxime ( 99mTc-HMPAO) SPECT disclosed a hypoperfusion of the cerebellar vermis, pons, and basal ganglia. Brain MRI showed remarkable atrophy of the cerebellum and a slight atrophy of the pontine tegmentum. Her pupils reacted to 1% pilocarpine, but not to 0.2% pilocarpine. Blood and urine laboratory findings were normal. Her speech was ataxic slight limb ataxia was detected in the limbs and her gait was wide based and ataxic. Babinski’s and Chaddock’s signs were positive on both sides. ![]() The deep tendon reflexes were augmented in her upper and lower limbs. The distal muscles of the limbs were slightly weak, although muscle tone was normal. Her tongue showed atrophy and fasciculation. The extraocular movements were saccadic and the upper gaze of both eyes was slightly limited. Neurological examination showed bilateral mydriasis (7.0 mm in diameter) and light-near dissociation (figure). The condition of our patient deteriorated gradually, and she was admitted to our hospital in April, 1997. Her mother had had gait disturbance since her 20s and died of pneumonia at the age of 35. Thereafter, she noticed difficulties in speech and in the fine movement of her hands. Patient 1 was a 21 year old woman who complained of gait instability in 1996. We present a patient with spinocerebellar ataxia type 1 (SCA1) and her asymptomatic younger brother who both exhibited pseudo-Argyll Robertson pupil. Dilute pilocarpine constricts the pupils of patients with Holmes-Adie pupil, but it is not effective in patients with pseudo-Argyll Robertson pupil. The responsible lesion in pseudo-Argyll Robertson pupil is in the central region, whereas that of Holmes-Adie pupil is peripheral. 1 Although the appearance of pseudo-Argyll Robertson pupil is very similar to Holmes-Adie pupil, the first is distinguishable from the second by the location of lesions and pharmacological response. It has been reported in patients with diabetes mellitus, multiple sclerosis, Wernicke’s encephalopathy, sarcoidosis, tumours, and haemorrhage. A pseudo-Argyll Robertson pupil is a neurological sign indicating a normal near reflex but the absence of a light reflex (light-near dissociation), a lack of miosis, and pupil irregularity. ![]()
0 Comments
Leave a Reply.AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |